Development of a Molecular Beacon-Based Genosensor for Detection of Human Rotavirus A
摘要
The rotavirus-led fatal infantile gastroenteritis in the globe demands a portable, specific, and low-cost diagnostic tool for its timely detection and effective surveillance in a mass population. Consequently, the design and development of an advanced biosensing technique for its detection is of paramount importance. A highly conserved 23-nucleotide sequence, 5' GCTAGGGATAAGATTGTTGAAGG 3', was identified by a human rotavirus A VP6 gene sequence analysis and designated as the target. A molecular beacon of 33 nucleotides was designed with the sequence 5'[Fluorescein] ATAGTCCTTCAACAATCTTATCCCTAGCACTAT[Dabcyl]3', incorporating stem and loop regions. Secondary and tertiary structure characterizations confirmed the desired stem-loop structure without internal secondary structures. The thermal stability of the molecular beacon-target complex was studied using a temperature vs. Gibbs free energy change plot, melting curve analysis based on absorbance vs. temperature, and an experimental fluorescence resonance energy transfer melting assay. The melting temperature of the molecular beacon-target complex was experimentally determined to be 62 °C. The spectral analysis showed fluorescence restoration in the presence of the synthetic VP6 target. The assay conditions were optimized with an excitation wavelength of 470 nm and a 10-min incubation time. The assay demonstrated a linear correlation between fluorescence intensity restoration and target concentration, with a limit of detection of 18.8 nM. Interference studies with single mismatch, double mismatch, and scrambled targets revealed that the molecular beacon has strong specificity for the VP6 target, effectively discriminating against non-target sequences. This work demonstrates the molecular beacon’s potential as a sensitive and specific tool for detecting rotavirus A VP6 gene, with promising applications in diagnostic assays for the rotavirus disease management.
Graphical Abstract